Hi, community,
I am new to MEGAN6. I have read some papers that listed MEGAN can be used for Hiseq shotgun assembled reads taxonomy assignment. I have looked at the manual of MEGAN6, but still confusing. Since I want to custom a virus database, which includes 9314 RefGenomes from NCBI. Then assign the taxonomy with LCA algorithm.
May I know how to do this in MEGAN6?
PS. my downloaded ReGenome is in this format.
NC_030398.2 Maize-associated totivirus 2 isolate EC_Portoviejo, complete genome
GAAGAATACGAAGCCAAACCGTTGCCTCGTATTCTTTACCAACCTTCTGAGCCCCTGCTTTCTAGCTTTC
CTGCGCACTTGCCACCGCTCACAAGCTCCCACGCGTTTCGAGAGATGGACACCTTCGTAAGGCACTTCTT
I have finished local blastn in fmt 6, which result in a table in the attachment. MEGAHIT_C1_1_blastn_virus_f6 (65.7 KB)
Thanks so much.
Sincerely.