Malt-run is reporting 0 reads from fastq files

MALT: Megan Alignment Tool
1

I am trying to prepare some illumina fastq data for analysis with MEGAN, but MALT does not seem to detect any reads in my fastq files (which contain a total of ~9K reads).

I have built a MALT index from the genbank collection of all bacterial samples, and though there are no errors when I use malt-run, MALT standard output returns that Total reads: 0 for all files. The fastqs have been produced by samtools after some processing of the original fq files, and they look like normal fastqs to me.

Am I misinterpreting the output from MALT? Is there an error somewhere?

Commands used for malt-build and malt-run:

$MALT/malt-build -i ~/myco/genbank_bac_genomes/. -d index --sequenceType DNA

$MALT/malt-run -i Myco_16S_region_reads/* -d index -m BlastN -o malt_out

The output from malt-run for the first fq file, after it successfully reads in the index files:

— ALIGNING —:
+++++ Aligning file: Myco_16S_region_reads/Av.fq
Starting file: malt_out/Av.rma6
100% (0.1s)
Finishing file: malt_out/Av.rma6
Loading MEGAN File: Av.rma6
Analyzing reads & alignments: Initialization
Analyzing…
Processing alignments
Total reads: 0
With hits: 0
Alignments: 0
Assig. Taxonomy: 0
MinSupport set to: 1
Applying min-support & disabled filter to Taxonomy…
Min-supp. changes: 0
Writing classification tables
Numb. Tax. classes: 0
Syncing
Class. Taxonomy: 0
Analysis written to file: malt_out/Av.rma6
Num. of queries: 0
Aligned queries: 0
Num. alignments: 0

A section of one of the fastqs:

@M_D00540:145:H2YYLBCXY:1:1101:5210:3444
GCGTTCGTCTTGAGCCAGGATCAAACTCTCCAAACAATGTC
+
JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
@M_D00540:145:H2YYLBCXY:1:1116:2385:78437
CCAGCGTTCGTCCTGAGCCAGGATCAAACTCTCCAAACAATGT
+
JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ

2

I just ran MALT on a file containing the two reads that you posted- no problems with the reads, both are processed and MALT reports Num. of queries: 2
Could you please give me access to a small input file that exhibits the problem that you are faced with.

3

Thanks for the reply Daniel! I’m still getting the same problem with my original files, but when I split up the fastq files, all of the subsets seem to run fine. The unprocessed fastqs that these files were produced from also runs fine through MALT. So I have a couple of ways to work around it at least!

Here’s one of my fastq files that is producing the Total reads 0 problem if you are interested in trying it at your end:
https://drive.google.com/file/d/0B8BqxTBr8VQuTlJtRmFORHFqSDA/view

MALT returns 0 reads for this file, even when I run it at the same time as the subsets containing all the same reads, and the subsets all return the expected number of reads.

I’ll use either the subsets or the raw data for now but if there’s anything else I can tell you, or if you do figure out what’s going on, let me know!