Hello,
Me again!! Now I have the problem that when I used contigs and reads at the same time in my Blastn input file (choosing the aligned bases mode), it generated me the display alignments error “reads sequences appear to be missing from RMA file”. When I chose the inspect option, In the case of ALL reads I only have the name of the fasta sencuences, example:.
DATA
NS500560_00101_FC_HK5GTBGX2:4:13402:4024:2608#TAAGGCGA+ATAGAGAG/1/1
but if I saw the contigs, they have the nucleotide sequences, example:
DATA[length=535]
contig-45_26 length_535 read_count_1327
GGATAAGAGCACATTATGACCCTGAAACTGGGTACAGAGATTCCCGGCACCAGTGCCGAGGGCAACATCACCACCATCTGGGTGCCGATGATCAAGAACATCAAGGCCCCGACCATCATCGAGCTCGAGGCCGGCACCGA
CATCTCGAACTACGTCATGCTCGGCGGCTGGAGCTTCGACCCGTCGCAGGACACCGTATCCGACCAGCGCGAGAACACCGTGCAGGACTTCGGGGCCCCCGGCCGCAAGAGCGCCGGCGACATCAGCATCGAGGTCATCG
ACAACACGAACACGGAGCACAAGGAGCAGAACGAGGCCGTCACCCTCATGCACGAGGGTGCCTCCGGCTATATCGTGCGTCGTCGCGGCATGGCCACCGACGCGCCATTGGCCTCCGGCCAGAAGCTCACCGTCGTGAGC
GTGAAGTGCGGCGAGAAGAAGGTCATCAACCCTGATGCGAACACCATGATCCGCAGTCAGATCCCGCTGTTCGCCCAGGCTCCCGGCTGGGAGTCCGAGACCGCCGATATCCTCC
When I reviewed the log file I find that for all my reads sequences have the next warnings
WARNING: Failed to find read ‘NS500560_00101_FC_HK5GTBGX2:1:11107:15067:3371#TAAGGCGA+ATAGAGAG/1/1’ in file: E:\Data\Trabajo\BioInformatica\Arias\Muestras\Xoxocotla\Tercer\VH02 D-1.fasta
WARNING: Failed to find read ‘NS500560_00101_FC_HK5GTBGX2:1:11107:1096:4589#TAAGGCGA+ATAGAGAG/1/1’ in file: E:\Data\Trabajo\BioInformatica\Arias\Muestras\Xoxocotla\Tercer\VH02 D-1.fasta
…
…
But if I do a grep with the read names over my input fasta file, I correctly find them.
Can you help me to figure out what is happening and how can I correct it?
Best wishes,